>|octo-repeat PrP mRNA(PrPmRNA)
AACACUGGGGGCAGCCGAUACCCGGGGCAGGGCAGCCCUGGAGGCAACCGCUACCCACCUCAGGGCGGUGGUGGCUGGGGGCAGCCUCAUGGUGGUGGCUGGGGGCAGCCUCAUGGUGGUGGCUGGGGGCAGCCCCAUGGUGGUGGCUGGGGACAGCCUCAUGGUGGUGGCUGGGGUCAAGGAGGUGGCACCCAC
CUCAGGGCGGUGGUGGCUGGGGGCC