Synchrotron SAXS
data from solutions of
La-related protein 6 (LARP6) N-terminal domain (NTD) bound to CTNNA1 P1 RNA, a fragment of the 3'-untranslated region of catenin alpha 1
in
25 mM Tris-HCl, 100 mM KCl, 5 mM MgCl2, 1 mM DTT, pH 7.5
were collected
on the
B21 beam line
at the Diamond Light Source storage ring
(Didcot, UK)
using a Eiger 4M detector
at a sample-detector distance of 3.7 m and
at a wavelength of λ = 0.09537 nm
(I(s) vs s, where s = 4πsinθ/λ, and 2θ is the scattering angle).
Solute concentrations ranging between 3.5 and 4.5 mg/ml were measured
at 15°C.
600 successive
0.350 second frames were collected.
The data were normalized to the intensity of the transmitted beam and radially averaged; the scattering of the solvent-blank was subtracted.
The low angle data collected at lower concentration were merged with the highest concentration high angle data to yield the final composite scattering curve.
LARP6 NTD, comprising the N-terminal disordered tail (NTR) and the structured La-motif and RNA-recognition motif (theoretical molecular weight 33.9 kDa), in bound state to a 25-mer from the 3'-untranslated region of catenin alpha 1 mRNA (sequence 5' CUAAAUACAACACUGAUACUAGAUU 3'; theoretical molecular weight 7.92 kDa).
Experimental molecular weight was estimated by SEC-MALLS.
s, nm-1
