>|DNA Duplex
TGAAGTTAACGCTTAACGTTAAGGGTTAATGA