>|ADP-ribosylation factor1 - short(ARF1 RNA - short)
GGCAGAAGCUGCCUCUUCGGAGGCAGUUUCUGCC