La-related protein 6

LARP6 protein

Organism: Homo sapiens

Monomeric molecular weight: 34.8 kDa

Oligomeric state: Monomer

Total molecular weight: 34.8 kDa

UniProt: Q9BRS8 (70-300)

Sequence:

GTTASGGENEREDLEQEWKPPDEELIKKLVDQIEFYFSDENLEKDAFLLKHVRRNKLGYVSVKLLTSFKKVKHLTRDWRTTAHALKYSVVLELNEDHRKVRRTTPVPLFPNENLPSKMLLVYDLYLSPKLWALATPQKNGRVQEKVMEHLLKLFGTFGVISSVRILKPGRELPPDIRRISSRYSQVGTQECAIVEFEEVEAAIKAHEFMITESQGKENMKAVLIGMKPPKKKP

LARP6 La-module, comprising the structured La-motif and RNA-recognition motif (theoretical molecular weight 26.9 kDa), in bound state to a 25-mer from the 3'-untranslated region of catenin alpha 1 mRNA (sequence 5' CUAAAUACAACACUGAUACUAGAUU 3'; theoretical molecular weight 7.92 kDa)